Plan ID: H5322-028. Have Medicare questions? Talk to a licensed agent today to find a plan that fits your needs. Get Medicare Help $ 0.00. Monthly Premium. UHC Dual Complete OH-D002 (HMO-POS D-SNP) is a HMO-POS Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcareContact Provider Call Center. 1-800-445-1638 - Available from 8:00 a.m. - 5:00 p.m. Central Time. UnitedHealthcare Dual Complete® Special Needs Plans (SNP) offer benefits for people with both Medicare and Medicaid, with benefits beyond Original Medicare including transportation to medical appointments and vision exams.Y0066_ANOC_H5322_030_000_2023_M. Y0066_210610_INDOI_C Find updates to your plan for next year This notice provides information about updates to your plan, but it ...2018 UnitedHealthcare Dual Complete (HMO-POS SNP) - H5322-030- in GA Plan Benefits DetailsPK !@r‰Š€ [Content_Types].xml ¢ ( ¬TÉnÂ0 ½Wê?D¾VÄÀ¡ª* ‡.Ç ú & ˆEb[ž Âßwb U %ŠÈ%VbÏ[fœ7šìª2ÙB@ãl& i_$`s§ ]eâkþÞ{ ’²Z•ÎB&ö ...H5322-028-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_028_000_2023_MSummary of Benefits 1. 2023-H5325.005.1. H5325-005 . Aetna Medicare Assure Gold Prime (HMO D‑SNP) H5325 ‑ 005. Here's a summary of the services we cover from January 1, 2023 through December 31, 2023. Keep in mind: This is just a summary.Jan 1, 2023 · H5322-025-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_025_000_2023_M R5342:006-0 UHC Medicare Advantage NY-0022 (Regional PPO) R6801:012-0 UHC Medicare Advantage TX-0030 (Regional PPO) R7444:001-0 AARP Medicare Advantage from UHC NG-0001 (Regional PPO) Compare the 600 Medicare Advantage plans available from UnitedHealthcare through Alight Retiree Health Solutions. Number of Members enrolled in this plan in (H5322 - 025): 52,170 members : Plan’s Summary Star Rating: 5 out of 5 Stars. This plan qualifies for the 5-star rating Special Enrollment period. Read more. • Customer Service Rating: 5 out of 5 Stars. • Member Experience Rating: 5 out of 5 Stars. • Drug Cost Accuracy Rating: 4 out of 5 Stars. H5322 - 025 - 0 (5 / 5) UnitedHealthcare Dual Complete (HMO-POS D-SNP) is a Medicare Advantage (Part C) Special Needs Plan by UnitedHealthcare. Premium: $25.00 Enroll Now This page features plan details for 2023 UnitedHealthcare Dual Complete (HMO-POS D-SNP) H5322 - 025 - 0 available in Select Counties in Texas.0956 981 2670. (Mga Pananaw: 10, Mga Komento: 0, Rating: Neutral) Nakatanggap ka ba ng isang tawag mula sa numero 0253229910 / (02) 5322 9910 mula sa Pilipinas at hindi alam kung sino ito? Tingnan ang mga mungkahi na iniwan ng ibang tao tungkol sa numerong ito o ibahagi ang iyong sariling komento.Plan ID: H5322-031-000 * Every year, the Centers for Medicare & Medicaid Services (CMS) evaluates plans based on a 5-star rating system. $0.00 Monthly Premium. Oklahoma Medicare beneficiaries may want to consider reviewing their Medicare Advantage (Medicare Part C) plan options. ...Georgia Select Counties in Georgia. 2023. GNHH4HIEN_23_C Summary of Benefits H5216206000SB23. Pre-Enrollment Checklist. Before making an enrollment decision, it is important that you fully understand our benefits and rules. If you have any questions, you can call and speak to acustomer service representative at 1-800-833-2364 (TTY: 711) .H5322- 025H- UnitedHealthcare Dual Complete (HMO D-SNP) H4527-024A- AARP Medicare Advantage Patriot (HMO-POS) H4527- 024H-AARP Medicare Advantage Patriot (HMO-POS) H4527-039 - UnitedHealthcareChronic Complete (HMO C-SNP) H4527- 037-AARP Medicare Advantage Plan 1 (HMO-POS) H1278-004A-AARP Medicare Advantage Walgreens (PPO)Y0066_EOC_H5322_030_000_2024_C. OMB Approval 0938-1051 (Expires: February 29, 2024) January 1 - December 31, 2024 Evidence of Coverage Your Medicare Health Benefits and Services and Prescription Drug Coverage as a Member of our plan This document gives you the details about your Medicare health care and prescription drugSummary of Benefits 2023. UnitedHealthcare Dual Complete® (PPO D-SNP) H0271-005-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free1-855-545-9340, TTY711. 8 a.m.-8 p.m. local time, 7 days a week.... 02,2019, 1113-0038, Local Organization, Charitable ... H# 5322/007,, [email protected]. 1798, 1798, DARUL ... 030,, [email protected]. 3428, 3428 ...Benefits In-Network Hearing Services Exam to diagnose and treat hearing and balance issues2 $0 copay Routine hearing exam $0 copay; 1 per year Hearing aid2 $375 - $2,075 copay for each hearing aid provided through UnitedHealthcare Hearing, up to 2 hearingPlan ID: H5322-031-000 * Every year, the Centers for Medicare & Medicaid Services (CMS) evaluates plans based on a 5-star rating system. $0.00 Monthly Premium. Oklahoma Medicare beneficiaries may want to consider reviewing their Medicare Advantage (Medicare Part C) plan options. ...Page 1 of 8 2023 Enrollment Request Form o UnitedHealthcare Dual Complete® (HMO-POS D-SNP) H5322-030-000 - UD5 Information about you (Please type or print in black or blue ink) Last Name First Name Middle Initial Birth Date Sex ¨ Male ¨ FemaleH5322-033-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_033_000_2023_MAARP Medicare Advantage from UHC SC-0006 (HMO-POS) is a HMO-POS Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcare. Plan ID: H5322-044-000. * Every year, the Centers for Medicare & Medicaid Services (CMS) evaluates plans based on a 5-star rating system. $31.00 Monthly Premium. South Carolina Medicare beneficiaries …Emergency care/Urgent care. • Emergency: $0 or $90 copay per visit (always covered) • Urgent care: $0 or $65 copay per visit (always covered) Inpatient hospital coverage. • In 2020 the amounts for each benefit period are $0 or: $1,408 deductible for days 1 through 60. $352 copay per day for days 61 through 90.Claims, billing and payments. Health care provider claim submission tools and resources. Learn how to submit a claim, submit reconsiderations, manage payments, and search remittances. Health care professionals working with UnitedHealthcare can use our digital tools to access claims, billing and payment information, forms and get live help.UnitedHealthcare - H5322 For 2024, UnitedHealthcare - H5322 received the following Star Ratings from Medicare: Overall Star Rating: 4 stars Health Services Rating: 4 stars Drug Services Rating: 4 stars Every year, Medicare evaluates plans based on a 5-star rating system. Why Star Ratings are Important Medicare rates plans on their health and ...2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsANSI: 5322 420-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0043 kg. Release date (ValFrom20) 3/1/99 . Release pack id (RELEASEPACK ...Medicare Plan Name: UnitedHealthcare Dual Complete (HMO-POS D-SNP) Location: Jefferson, Georgia Click to see other locations. Plan ID: H5322 - 030 - 0 Click to see …0956 981 2670. (Mga Pananaw: 10, Mga Komento: 0, Rating: Neutral) Nakatanggap ka ba ng isang tawag mula sa numero 0253229910 / (02) 5322 9910 mula sa Pilipinas at hindi alam kung sino ito? Tingnan ang mga mungkahi na iniwan ng ibang tao tungkol sa numerong ito o ibahagi ang iyong sariling komento.Page 1 of 8 2024 Enrollment Request Form o UHC Dual Complete GA-D002 (HMO-POS D-SNP) H5322-030-000 - B72 Information about you (Please type or print in black or blue ink) Last name First name Middle initial Birth date Sex ¨ Male ¨ FemaleUnitedHealthcare Dual Complete® (HMO-POS D-SNP) dummy spacing Benefits In-Network Inpatient Hospital Care2 $0 copay - $1,556 copay per stay Our plan covers an unlimited number of days for anEmergency care/Urgent care. • Emergency: $0 or $90 copay per visit (always covered) • Urgent care: $0 or $65 copay per visit (always covered) Inpatient hospital coverage. • In 2020 the amounts for each benefit period are $0 or: $1,408 deductible for days 1 through 60. $352 copay per day for days 61 through 90. The UnitedHealthcare Dual Complete (HMO-POS D-SNP) (H5322 - 030) currently has 42,771 members. There are 2,116 members enrolled in this plan in DeKalb, Georgia, and 42,689 members in Georgia. The Centers for Medicare and Medicaid Services (CMS) has given this plan carrier a summary rating of 5 stars. Inpatient hospital coverage. • In-network: In 2020 the amounts for each benefit period are $0 or: $1,408 deductible for days 1 through 60. $352 copay per day for days 61 through 90. $0 per day for days 91 and beyond (authorization required) • Out-of-network: Not Applicable (authorization required)H5322-041-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-723-6473, TTY 711 8 a.m.-8 p.m. local time, 7 days a week AARPMedicarePlans.com Y0066_SB_H5322_041_000_2024_M. AARPMedicarePlans.comTTY users should call 1-877-486-2048, 24 hours a day/ 7 days a week or consult www.medicare.gov; the Social Security Office at 1-800-772-1213 between 7 a.m. and 7 p.m., Monday through Friday. TTY users should call, 1-800-325-0778; or your state Medicaid Office. Medicare evaluates plans based on a 5-Star rating system.H5322-025-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_025_000_2023_MH5322 - 031 - 0 Click to see other plans: Member Services: 1-844-368-7150 TTY users 711 — This plan information is for research purposes only. — Click here to see plans for the current plan year: Medicare Contact Information: Please go to Medicare.gov or call 1-800-MEDICARE (1-800-633-4227) to get information on all of your options.Number of Members enrolled in this plan in (H5322 - 038): 726 members : Plan's Summary Star Rating: 4 out of 5 Stars. • Customer Service Rating: 4 out of 5 Stars. • Member Experience Rating: 5 out of 5 Stars. • Drug Cost Accuracy Rating: 3 out of 5 Stars. — Plan Premium Details — The Monthly Premium is Split as Follows: : Total ...2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details 4 out of 5 stars* for plan year 2024. UHC Dual Complete OK-S002 (HMO-POS D-SNP) is a HMO-POS D-SNP Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcare. Plan ID: H5322-031-000. * Every year, the Centers for Medicare & Medicaid Services (CMS) evaluates plans based on a 5-star rating system. $0.00 Monthly Premium. Jan 1, 2024 · Y0066_INTRO_2024_M UHEX24HM0154138_000 UCard opens doors where it matters Once you re a member, you ll receive your new UnitedHealthcare UCard in the mail. Inpatient hospital coverage. • In 2018 the amounts for each benefit period are $0 or: $1,340 deductible for days 1 through 60. $335 copay per day for days 61 through 90. Outpatient hospital coverage. • 0% or 20% per visit. Preventive care. • $0 copay.Quick Reference and Overview 2024 Plan Resource Materials. Quick Reference Guides. 2024 UHC Dual Complete TX Quick Reference Guide: H2406-050-000, H4514-013-001, H4514-013-002, H4514-013-003, H4514-019-000, H4514-021-000 2024 UHC Dual Complete TX Quick Reference Guide: H5322-025-000, H5322-038-000 2024 UHC Dual Complete …H1278-016-AARP Medicare Advantage Choice (PPO) H5322-026-UnitedHealthcare Dual Complete Plan 2 (HMO D-SNP) H5322-025C-UnitedHealthcare Dual Complete (HMO D-SNP) H0028-029-Humana Gold Plus San(HMO) Antonio H0028-036C-Humana Gold Plus (HMO D-SNP) H4590 - 010 - AARP Medicare Advantage SecureHorizons (HMO)AARP Medicare Advantage Plan 2 (HMO-POS) is a Medicare Advantage (Part C) Plan by UnitedHealthcare. Premium: $28.00. Enroll Now. This page features plan details for 2023 AARP Medicare Advantage Plan 2 (HMO-POS) H5253 - 048 - 0 available in Select Counties in Tennessee and Virginia. IMPORTANT: This page features the 2023 version of this plan.2017 UnitedHealthcare Dual Complete (HMO-POS SNP) - H5322-030- in GA Star Rating Details2020 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsCaller: 02 5322 2392; Call type: Scam suspicion; Reply! 0. anonymous. 9 Apr 2022. I got a call from 02-5322-2392 and yet no one is speaking. Reply! 0. Blk. 12 Apr 2022. Call spam..didnt pick up since its very suspicious. Reply! 0. BokBok. 3 Jun 2022. This number keeps on annoying me for frequent calling. Like 3 times a day.H5322-031-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m. - 8 p.m. local time, 7 days a week www.UHCCommunityPlan.com Y0066_SB_H5322_031_000_2022_M2024. H7518-003. Wellcare Mutual of Omaha Low Premium Open (PPO) 2024. H7518-004. Wellcare No Premium Value (HMO-POS) 2024. H1416-082. Discover Medicare insurance plans accepted at our Truman health center and find primary care doctors accepting Medicare near you.ANSI: 5322 266-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0093 kg. Release date (ValFrom20) 02/12/1996 . Release pack id (RELEASEPACK) 97.1 . Join us. Stay updated. Sign up for our newsletter today. Email * Sign up . Career Contact us About Sandvik Coromant For press Safety information .Effective Jan. 1, 2024. UnitedHealthcare offers a Medicare Advantage plan in your area known as UHC Dual Complete GA-D002 (HMO-POS D-SNP), a Dual Special Needs Plan (D-SNP), for individuals who are eligible for both Medicaid and Medicare. Number of Members enrolled in this plan in (H5322 - 030): 47,735 members : Plan’s Summary Star Rating: 4 out of 5 Stars. • Customer Service Rating: 4 out of 5 Stars. • Member Experience Rating: 5 out of 5 Stars. • Drug Cost Accuracy Rating: 3 out of 5 Stars. — Plan Premium Details — The Monthly Premium is Split as Follows: : Total ... ANSI: 5322 230-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0018 kg. Release date (ValFrom20) 3/1/99 . Release pack id ...The UnitedHealthcare Dual Complete (HMO-POS D-SNP) (H5322 - 030) currently has 11,173 members. There are 49 members enrolled in this plan in Evans, Georgia, and 11,095 members in Georgia. The Centers for Medicare and Medicaid Services (CMS) has given this plan carrier a summary rating of 4.5 stars. The detail CMS plan carrier ratings are as ...5 out of 5 stars. UHC Dual Complete GA-D002 (HMO-POS D-SNP) is a HMO-POS Medicare Advantage (Medicare Part C) plan offered by UnitedHealthcare. Plan ID: …Gene symbol: ZNF219 Gene: 51222: Uniprot Function: Transcriptional regulator (PubMed:14621294, PubMed:19549071). Recognizes and binds 2 copies of the core DNA sequence motif 5'-GGGGG-3' (PubMed:14621294). UHC Dual Complete GA-D002 (HMO-POS D-SNP) is a Medicare Advantage plan offered by UnitedHealthcare that combines Original Medicare benefits with prescription drug coverage and other extra benefits. The plan has a monthly premium of $0.00, a deductible of $0.00, and a copayment for primary care office visits of $0.00. ANSI: 5322 266-02. remove add. shopping_cart Add to cart . Product data. Weight of item (WT) 0.0093 kg. Release date (ValFrom20) 02/12/1996 . Release pack id (RELEASEPACK) 97.1 . Join us. Stay updated. Sign up for our newsletter today. Email * Sign up . Career Contact us About Sandvik Coromant For press Safety information .In-Network: Days 1-7: $295.00 per day, per admission / Days 8-90: $0.00 per day, per admission. Additional Hospital Days: Unlimited additional days. Urgent care. Urgent Care: $50.00 copay. Emergency room visit. Emergency Care: $90.00 copay. Worldwide Coverage: This plan covers urgent care and emergency services when traveling outside of the ...2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Plan Benefits Explained2020 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details2021 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsDate: 07.02.21 Client Contact: Rebecca Lambert Art Director/Designer: catchfire Project Details ... Notes. Title: 2023 UnitedHealthcare Dual Complete Plan Benefit Flyer H5322-025-000 no QMB card Subject: UnitedHealthcare Dual Complete additional benefit overview for health care professionals. Created Date:2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsPlan ID: H5322-030-000 * Every year, the Centers for Medicare & Medicaid Services (CMS) evaluates plans based on a 5-star rating system. $0.00 Monthly Premium. Georgia Medicare beneficiaries may want to consider reviewing their Medicare Advantage (Medicare Part C) plan options. ...Y0066_EOC_H5322_030_000_2023_C. OMB Approval 0938-1051 (Expires: February 29, 2024) January 1 - December 31, 2023 Evidence of Coverage Your Medicare Health Benefits and Services and Prescription Drug Coverage as a Member of our plan This document gives you the details about your Medicare health care and prescription drugH5322-041-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-723-6473, TTY 711 8 a.m.-8 p.m. local time, 7 days a week AARPMedicarePlans.com Y0066_SB_H5322_041_000_2024_M. AARPMedicarePlans.com2024 UHC Dual Complete TX-D007 Frequently Asked Questions H5322-025-000 Subject: UnitedHealthcare Community Plan of Texas manages the Medicare Advantage benefits and reimburses you according to your existing contracted rates. Created Date: 12/15/2023 12:02:43 PMMember Services: 1-866-944-4983 TTY users 711. Medicare Contact Information: Please go to Medicare.gov or call 1-800-MEDICARE (1-800-633-4227) to get information on all of your options. TTY users 1-877-486-2048. or contact your local SHIP for assistance. Email a copy of the UHC Dual Complete TX-D007 (HMO-POS D-SNP) benefit details.2020 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsPremium: $35.90. Enroll Now. This page features plan details for 2023 UnitedHealthcare Dual Complete (HMO-POS D-SNP) H5322 - 030 - 0 available in Select Counties in Georgia. IMPORTANT: This page features the 2023 version of this plan. See the 2024 version using the link below: 2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) H5322 - 030 - 0.H5322-025-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-560-4944, TTY 711 8 a.m.-8 p.m. local time, 7 days a week UHCCommunityPlan.com Y0066_SB_H5322_025_000_2024_M.Summary of benefits 2022 Medicare Advantage plan with prescription drugs AARP® Medicare Advantage Plan 2 (HMO-POS) H5253-038-000 Look inside to take advantage of the health services and drug coverages the plan provides.2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsRNA-binding protein that interacts with purine-rich sequences and is involved in nuclear mRNA export; probably mediated by association with the TREX complex. Mitotic Index. 0.0218. Interphase Cluster: #76 (27 genes) Mitotic Cluster: #52 (29 genes) sgRNA 1: GCAGCATTAATTACAACTGG (interphase cells: 3439, mitotic cells: 70)
H5322-042-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-723-6473, TTY 711 8 a.m.-8 p.m. local time, 7 days a week AARPMedicarePlans.com Y0066_SB_H5322_042_000_2024_M. AARPMedicarePlans.comView and download important forms and documents about your BlueMedicare plan from Florida Blue. Call Member Services at 1-800-926-6565 (TTY 1-800-955-8770 ) Hours: 8:00 a.m. to 8:00 p.m. local time, seven days a week, from October 1 through March 31, except for Thanksgiving and Christmas. From April 1 through September 30, our hours are 8:00 …2021 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsHealthSpring Life & Health Insurance Company, Inc. HHS001042500002 H7849 039 Cigna True Choice Medicare (PPO) MAP Cameron, Hidalgo, Webb, Willacy2024 Medicare Advantage Plan Benefits explained in plain text. Plain text explanation available for any plan in any state. Sign-up for our free Medicare Part D Newsletter, Use the Online Calculators, FAQs or contact us through our Helpdesk -- Powered by Q1GROUP LLC and National Insurance Markets, IncLearn More about UnitedHealthcare UHC Dual Complete GA-D002 (HMO-POS D-SNP) Plan Details, including how much you can expect to pay for coinsurance, deductibles, premiums and copays for various services covered by the plan.Aero Design Part Number AD-C734-01-030 Page Aerospace Inc. Part Number C734-01-030 Next Higher Assembly:D734-02-001 - Box - Power Supply Assy Eligibility: IPC Reference: Quantity: See FAA-PMA Supplement 33-50 Upto 1 per NHA Location: Box-Power Supply Assy C&A-C734-01-030 AD-C734-01-030Summary of Benefits 2023. UnitedHealthcare Dual Complete® (PPO D-SNP) H0271-005-000 Look inside to take advantage of the health services and drug coverages the plan provides. Call Customer Service or go online for more information about the plan. Toll-free1-855-545-9340, TTY711. 8 a.m.-8 p.m. local time, 7 days a week.... 02 (H). Broderick Lillian R Mrs h241 S Prom apt 3 ... hl030 Frank¬ lin apt 3. Brown Leo F r RD 1 Box 230 (SS) ... h5322 Ash. Sanki Erna B Mrs cannery wkr Barbey ...2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Plan Benefits Explained2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsH5322-042-000 Look inside to learn more about the plan and the health and drug services it covers. Call Customer Service or go online for more information about the plan. Toll-free 1-844-723-6473, TTY 711 8 a.m.-8 p.m. local time, 7 days a week AARPMedicarePlans.com Y0066_SB_H5322_042_000_2024_M. AARPMedicarePlans.com2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details02-5322-9110 / 0253229110 calls (2) Report a phone call from 02-5322-9110 and help to identify who and why is calling from this number. 0. JENNIFER C. CARULLA. 23 Nov 2023.2020 UnitedHealthcare Dual Complete (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating DetailsMaximum 2 visits every year. Copayment for Dental X-Rays $0.00. Maximum 1 visit (Please see Evidence of Coverage for details) Maximum Plan Benefit of $3500.00 every year for Preventive and Non-Medicare Covered Comprehensive combined. Comprehensive Dental: Copayment for Medicare-covered Benefits $0.00.2024 UHC Dual Complete GA-D002 (HMO-POS D-SNP) - H5322-030- in GA Star Rating Details2023 Ohio UnitedHealthcare Dual Complete® Plan Frequently Asked Questions: H5322-028-000 Subject: UnitedHealthcare Community Plan of Ohio manages the Medicare Advantage benefits and reimburses you according to your existing contracted rates. Created Date: 20230221175353Z.